Review



eb3 mneongreen chertkova  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc eb3 mneongreen chertkova
    Eb3 Mneongreen Chertkova, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/eb3+mneongreen+chertkova/EB3-mNeonGreen+(Plasmid+%2398881)/pm35767949-301-58-63
    Average 93 stars, based on 11 article reviews
    eb3 mneongreen chertkova - by Bioz Stars, 2026-10
    93/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title: Loss of Stathmin-2, a hallmark of TDP-43-associated ALS, causes motor neuropathy.
    Article Snippet: SV2 DSHB AB2315387 Alexa fluoro-568 anti-mouse Thermo Scientific A-21124 Chemicals, peptides, and recombinant proteins Toluidine Blue O Fisher Scientific T16125 cOmplete, EDTA-free Protease Inhibitor Cocktail Sigma-Aldrich 11873580001 Laminin, Mouse, natural Sigma-Aldrich 23017015 Ammonium formate Sigma-Aldrich 70221-100G-F Osmium Tetroxide Sigma-Aldrich 251755-10mL Nerve growth factor (NGF) Sigma-Aldrich N6009-4X25UG Neurobasal Medium ThermoFisher 21103049 Penicillin-Streptomycin (10,000 U/mL) ThermoFisher 15140122 Poly-D-lysine hydrobromide Sigma-Aldrich P7280 5-Fluoro-20-deoxyuridine (FUDR) Sigma-Aldrich F0503 B-27 Supplement, serum free ThermoFisher 17504044 D-(+)-Glucose solution Sigma-Aldrich G8644 Paraformaldehyde, 32% solution Electron Microscopy Sciences 15714-S Fetal Bovine Serum, Heat Inactivated ThermoFisher 10500064 Critical commercial assays Pierce BCA Protein Assay Kit ThermoFisher 23227 Araldite 502 epoxy resin solution Electron Microscopy Science 13900 Spurr Resin kit Electron Microscopy Science 14300 Rotarod Assay Panlab LE8205 Viking Quest Electromyography Device Nicolet N/A Experimental models: Organisms/strains Mouse: Stmn2 KO This paper N/A Mouse: Stmn2 floxed This paper N/A Mouse: Rosa26-LSL-Cas9 knockin Cas9 mouse The Jackson Laboratory JAX:024857 (Continued on next page) e1 Cell Reports 39, 111001, June 28, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: ChAT-IRES-Cre The Jackson Laboratory JAX:006410 Mouse: SARM1 B6.129X1-Sarm1tm1Aidi/J The Jackson Laboratory JAX:018069 Oligonucleotides Guide RNA targeting STMN2 Sequence #1: AGGTGAAGCAGATCAACAAC This paper N/A Guide RNA targeting STMN2 Sequence #2: GAAGAAAGACCTGTCTCTGG This paper N/A Scramble guide RNA sequence: CGCGGCAGCCGGTAGCTATG This paper N/A Recombinant DNA FCIV- NC vector Essuman et al. (2017) N/A Plasmid: EB3-mNeonGreen Chertkova et al. (2017) Addgene #98881 Plasmid: LentiGuide-Puro Sanjana et al. (2014) Addgene #52963 Software and algorithms Graph Pad Prism 9 GraphPad Software https://www.graphpad.com/scientific- software/prism/ Kymolyzer Basu et al. (2020) https://github.com/ThomasSchwarzLab/ KymolyzerCodes KymoButler Jakobs et al. (2019) https://www.wolframcloud.com/objects/ deepmirror/Projects/KymoButler/ KymoButlerForm ImageJ Schneider et al. (2012) RRID:SCR_003070 Other FluoroDishes World Precision Instruments FD35-100 4-well Chamber Slides Fischer Scientific 08-774-25 Article ll OPEN ACCESS ..

    Recombinant:

    Article Title: Loss of Stathmin-2, a hallmark of TDP-43-associated ALS, causes motor neuropathy.
    Article Snippet: SV2 DSHB AB2315387 Alexa fluoro-568 anti-mouse Thermo Scientific A-21124 Chemicals, peptides, and recombinant proteins Toluidine Blue O Fisher Scientific T16125 cOmplete, EDTA-free Protease Inhibitor Cocktail Sigma-Aldrich 11873580001 Laminin, Mouse, natural Sigma-Aldrich 23017015 Ammonium formate Sigma-Aldrich 70221-100G-F Osmium Tetroxide Sigma-Aldrich 251755-10mL Nerve growth factor (NGF) Sigma-Aldrich N6009-4X25UG Neurobasal Medium ThermoFisher 21103049 Penicillin-Streptomycin (10,000 U/mL) ThermoFisher 15140122 Poly-D-lysine hydrobromide Sigma-Aldrich P7280 5-Fluoro-20-deoxyuridine (FUDR) Sigma-Aldrich F0503 B-27 Supplement, serum free ThermoFisher 17504044 D-(+)-Glucose solution Sigma-Aldrich G8644 Paraformaldehyde, 32% solution Electron Microscopy Sciences 15714-S Fetal Bovine Serum, Heat Inactivated ThermoFisher 10500064 Critical commercial assays Pierce BCA Protein Assay Kit ThermoFisher 23227 Araldite 502 epoxy resin solution Electron Microscopy Science 13900 Spurr Resin kit Electron Microscopy Science 14300 Rotarod Assay Panlab LE8205 Viking Quest Electromyography Device Nicolet N/A Experimental models: Organisms/strains Mouse: Stmn2 KO This paper N/A Mouse: Stmn2 floxed This paper N/A Mouse: Rosa26-LSL-Cas9 knockin Cas9 mouse The Jackson Laboratory JAX:024857 (Continued on next page) e1 Cell Reports 39, 111001, June 28, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: ChAT-IRES-Cre The Jackson Laboratory JAX:006410 Mouse: SARM1 B6.129X1-Sarm1tm1Aidi/J The Jackson Laboratory JAX:018069 Oligonucleotides Guide RNA targeting STMN2 Sequence #1: AGGTGAAGCAGATCAACAAC This paper N/A Guide RNA targeting STMN2 Sequence #2: GAAGAAAGACCTGTCTCTGG This paper N/A Scramble guide RNA sequence: CGCGGCAGCCGGTAGCTATG This paper N/A Recombinant DNA FCIV- NC vector Essuman et al. (2017) N/A Plasmid: EB3-mNeonGreen Chertkova et al. (2017) Addgene #98881 Plasmid: LentiGuide-Puro Sanjana et al. (2014) Addgene #52963 Software and algorithms Graph Pad Prism 9 GraphPad Software https://www.graphpad.com/scientific- software/prism/ Kymolyzer Basu et al. (2020) https://github.com/ThomasSchwarzLab/ KymolyzerCodes KymoButler Jakobs et al. (2019) https://www.wolframcloud.com/objects/ deepmirror/Projects/KymoButler/ KymoButlerForm ImageJ Schneider et al. (2012) RRID:SCR_003070 Other FluoroDishes World Precision Instruments FD35-100 4-well Chamber Slides Fischer Scientific 08-774-25 Article ll OPEN ACCESS ..

    Plasmid Preparation:

    Article Title: Loss of Stathmin-2, a hallmark of TDP-43-associated ALS, causes motor neuropathy.
    Article Snippet: SV2 DSHB AB2315387 Alexa fluoro-568 anti-mouse Thermo Scientific A-21124 Chemicals, peptides, and recombinant proteins Toluidine Blue O Fisher Scientific T16125 cOmplete, EDTA-free Protease Inhibitor Cocktail Sigma-Aldrich 11873580001 Laminin, Mouse, natural Sigma-Aldrich 23017015 Ammonium formate Sigma-Aldrich 70221-100G-F Osmium Tetroxide Sigma-Aldrich 251755-10mL Nerve growth factor (NGF) Sigma-Aldrich N6009-4X25UG Neurobasal Medium ThermoFisher 21103049 Penicillin-Streptomycin (10,000 U/mL) ThermoFisher 15140122 Poly-D-lysine hydrobromide Sigma-Aldrich P7280 5-Fluoro-20-deoxyuridine (FUDR) Sigma-Aldrich F0503 B-27 Supplement, serum free ThermoFisher 17504044 D-(+)-Glucose solution Sigma-Aldrich G8644 Paraformaldehyde, 32% solution Electron Microscopy Sciences 15714-S Fetal Bovine Serum, Heat Inactivated ThermoFisher 10500064 Critical commercial assays Pierce BCA Protein Assay Kit ThermoFisher 23227 Araldite 502 epoxy resin solution Electron Microscopy Science 13900 Spurr Resin kit Electron Microscopy Science 14300 Rotarod Assay Panlab LE8205 Viking Quest Electromyography Device Nicolet N/A Experimental models: Organisms/strains Mouse: Stmn2 KO This paper N/A Mouse: Stmn2 floxed This paper N/A Mouse: Rosa26-LSL-Cas9 knockin Cas9 mouse The Jackson Laboratory JAX:024857 (Continued on next page) e1 Cell Reports 39, 111001, June 28, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: ChAT-IRES-Cre The Jackson Laboratory JAX:006410 Mouse: SARM1 B6.129X1-Sarm1tm1Aidi/J The Jackson Laboratory JAX:018069 Oligonucleotides Guide RNA targeting STMN2 Sequence #1: AGGTGAAGCAGATCAACAAC This paper N/A Guide RNA targeting STMN2 Sequence #2: GAAGAAAGACCTGTCTCTGG This paper N/A Scramble guide RNA sequence: CGCGGCAGCCGGTAGCTATG This paper N/A Recombinant DNA FCIV- NC vector Essuman et al. (2017) N/A Plasmid: EB3-mNeonGreen Chertkova et al. (2017) Addgene #98881 Plasmid: LentiGuide-Puro Sanjana et al. (2014) Addgene #52963 Software and algorithms Graph Pad Prism 9 GraphPad Software https://www.graphpad.com/scientific- software/prism/ Kymolyzer Basu et al. (2020) https://github.com/ThomasSchwarzLab/ KymolyzerCodes KymoButler Jakobs et al. (2019) https://www.wolframcloud.com/objects/ deepmirror/Projects/KymoButler/ KymoButlerForm ImageJ Schneider et al. (2012) RRID:SCR_003070 Other FluoroDishes World Precision Instruments FD35-100 4-well Chamber Slides Fischer Scientific 08-774-25 Article ll OPEN ACCESS ..

    Software:

    Article Title: Loss of Stathmin-2, a hallmark of TDP-43-associated ALS, causes motor neuropathy.
    Article Snippet: SV2 DSHB AB2315387 Alexa fluoro-568 anti-mouse Thermo Scientific A-21124 Chemicals, peptides, and recombinant proteins Toluidine Blue O Fisher Scientific T16125 cOmplete, EDTA-free Protease Inhibitor Cocktail Sigma-Aldrich 11873580001 Laminin, Mouse, natural Sigma-Aldrich 23017015 Ammonium formate Sigma-Aldrich 70221-100G-F Osmium Tetroxide Sigma-Aldrich 251755-10mL Nerve growth factor (NGF) Sigma-Aldrich N6009-4X25UG Neurobasal Medium ThermoFisher 21103049 Penicillin-Streptomycin (10,000 U/mL) ThermoFisher 15140122 Poly-D-lysine hydrobromide Sigma-Aldrich P7280 5-Fluoro-20-deoxyuridine (FUDR) Sigma-Aldrich F0503 B-27 Supplement, serum free ThermoFisher 17504044 D-(+)-Glucose solution Sigma-Aldrich G8644 Paraformaldehyde, 32% solution Electron Microscopy Sciences 15714-S Fetal Bovine Serum, Heat Inactivated ThermoFisher 10500064 Critical commercial assays Pierce BCA Protein Assay Kit ThermoFisher 23227 Araldite 502 epoxy resin solution Electron Microscopy Science 13900 Spurr Resin kit Electron Microscopy Science 14300 Rotarod Assay Panlab LE8205 Viking Quest Electromyography Device Nicolet N/A Experimental models: Organisms/strains Mouse: Stmn2 KO This paper N/A Mouse: Stmn2 floxed This paper N/A Mouse: Rosa26-LSL-Cas9 knockin Cas9 mouse The Jackson Laboratory JAX:024857 (Continued on next page) e1 Cell Reports 39, 111001, June 28, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: ChAT-IRES-Cre The Jackson Laboratory JAX:006410 Mouse: SARM1 B6.129X1-Sarm1tm1Aidi/J The Jackson Laboratory JAX:018069 Oligonucleotides Guide RNA targeting STMN2 Sequence #1: AGGTGAAGCAGATCAACAAC This paper N/A Guide RNA targeting STMN2 Sequence #2: GAAGAAAGACCTGTCTCTGG This paper N/A Scramble guide RNA sequence: CGCGGCAGCCGGTAGCTATG This paper N/A Recombinant DNA FCIV- NC vector Essuman et al. (2017) N/A Plasmid: EB3-mNeonGreen Chertkova et al. (2017) Addgene #98881 Plasmid: LentiGuide-Puro Sanjana et al. (2014) Addgene #52963 Software and algorithms Graph Pad Prism 9 GraphPad Software https://www.graphpad.com/scientific- software/prism/ Kymolyzer Basu et al. (2020) https://github.com/ThomasSchwarzLab/ KymolyzerCodes KymoButler Jakobs et al. (2019) https://www.wolframcloud.com/objects/ deepmirror/Projects/KymoButler/ KymoButlerForm ImageJ Schneider et al. (2012) RRID:SCR_003070 Other FluoroDishes World Precision Instruments FD35-100 4-well Chamber Slides Fischer Scientific 08-774-25 Article ll OPEN ACCESS ..



    Similar Products

    eb3 mneongreen chertkova  (Addgene inc)
    93
    Addgene inc eb3 mneongreen chertkova
    Eb3 Mneongreen Chertkova, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/eb3+mneongreen+chertkova/EB3-mNeonGreen+(Plasmid+%2398881)/pm35767949-301-58-63
    Average 93 stars, based on 1 article reviews
    eb3 mneongreen chertkova - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier

    Image Search Results